SH2D1A cDNA

Catalog Number: USB-552281
Article Name: SH2D1A cDNA
Biozol Catalog Number: USB-552281
Supplier Catalog Number: 552281
Alternative Catalog Number: USB-552281-10
Manufacturer: US Biological
Category: Molekularbiologie
SH2D1A encodes a protein that plays a major role in the bidirectional stimulation of T and B cells. This protein contains an SH2 domain and a short tail. It associates with the signaling lymphocyte-activation molecule, thereby acting as an inhibitor of this transmembrane protein by blocking the recruitment of the SH2-domain-containing signal-transduction molecule SHP-2 to its docking site. This protein can also bind to other related surface molecules that are expressed on activated T, B and NK cells, thereby modifying signal transduction pathways in these cells. Mutations in this gene cause lymphoproliferative syndrome X-linked type 1 or Duncan disease, a rare immunodeficiency characterized by extreme susceptibility to infection with Epstein-Barr virus, with symptoms including severe mononucleosis and malignant lymphoma. Multiple transcript variants encoding different isoforms have been found for this gene. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 387bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGACGCAGTGGCTGTGTATCATGGCAAAATCAGCAGGGAAACCGGCGAGAAGCTCCTGCTTGCCACTGGGCTGGATGGCAGCTATTTGCTGAGGGACAGCGAGAGCGTGCCAGGCGTGTACTGCCTATGTGTGCTGTATCACGGTTACATTTATACATACCGAGTGTCCCAGACAGAAACAGGTTCTTGGAGTGCTGAGACAGCACCTGGGGTACATAAAAGATATTTCCGGAAAATAAAAAATCTCATTTCAGCATTTCAGAAGCCAGATCAAGGCATTGTAATACCTCTGCAGTATCCAGTTGAGAAGAAGTCCTCAGCTAGAAGTACACAAGGTACTACAGGGATAAGAGAAGATCCTGATGTCTGCCTGAAAGCCCCATGA Translation Sequence: MDAVAVYHGK ISRETGEKLL LATGLDGSYL LRDSESVPGV YCLCVLYHGY IYTYRVSQTE TGSWSAETAP GVHKRYFRKI KNLISAFQKP DQGIVIPLQY PVEKKSSARS TQGTTGIRED PDVCLKAP Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 002342
Form: Supplied as a lyophilized powder.