SH2D1B cDNA

Catalog Number: USB-552282
Article Name: SH2D1B cDNA
Biozol Catalog Number: USB-552282
Supplier Catalog Number: 552282
Alternative Catalog Number: USB-552282-10
Manufacturer: US Biological
Category: Molekularbiologie
By binding phosphotyrosines through its free SRC homology-2 (SH2) domain, EAT2 regulates signal transduction through receptors expressed on the surface of antigen-presenting cells. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 399bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGATCTGCCTTACTACCATGGACGTCTGACCAAGCAAGACTGTGAGACCTTGCTGCTCAAGGAAGGGGTGGATGGCAACTTTCTTTTAAGAGACAGCGAGTCGATACCAGGAGTCCTGTGCCTCTGTGTCTCGTTTAAAAATATTGTCTACACATACCGAATCTTCAGAGAGAAACACGGGTATTACAGGATACAGACTGCAGAAGGTTCTCCAAAACAGGTCTTTCCAAGCCTAAAGGAACTGATCTCCAAATTTGAAAAACCAAATCAGGGGATGGTGGTTCACCTTTTAAAGCCAATAAAGAGAACCAGCCCCAGCTTGAGATGGAGAGGATTGAAATTAGAGTTGGAAACATTTGTGAACAGTAACAGCGATTATGTGGATGTCTTGCCTTGA Translation Sequence: MDLPYYHGRL TKQDCETLLL KEGVDGNFLL RDSESIPGVL CLCVSFKNIV YTYRIFREKH GYYRIQTAEG SPKQVFPSLK ELISKFEKPN QGMVVHLLKP IKRTSPSLRW RGLKLELETF VNSNSDYVDV LP Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 444512
Form: Supplied as a lyophilized powder.