SMNDC1 is a paralog of SMN1 gene, which encodes the survival motor neuron protein, mutations in which are cause of autosomal recessive proximal spinal muscular atrophy. The protein encoded by this gene is a nuclear protein that has been identified as a constituent of the spliceosome complex. This gene is differentially expressed, with abundant levels in skeletal muscle, and may share similar cellular function as the SMN1 gene. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 717bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGTCAGAGGATTTAGCAAAGCAGCTGGCAAGCTACAAAGCTCAGCTCCAGCAAGTTGAAGCTGCATTATCTGGAAATGGAGAAAATGAAGATTTGCTAAAATTGAAGAAAGATTTACAAGAAGTTATAGAACTAACCAAAGACCTTCTGTCAACTCAACCTTCTGAGACGCTTGCAAGTTCAGACAGTTTTGCTTCTACTCAACCTACTCATTCATGGAAAGTAGGAGACAAGTGTATGGCAGTCTGGAGTGAAGATGGACAGTGTTATGAAGCGGAGATTGAGGAGATAGATGAAGAAAATGGCACCGCTGCAATCACCTTTGCTGGTTATGGCAATGCTGAAGTGACTCCACTGTTGAACCTCAAGCCTGTAGAAGAAGGAAGGAAGGCAAAGGAGGACAGTGGCAACAAACCCATGTCAAAAAAAGAAATGATTGCCCAGCAGCGTGAATATAAAAAGAAGAAAGCTTTGAAAAAAGCTCAGAGAATAAAAGAACTTGAGCAGGAAAGAGAGGACCAGAAAGTGAAATGGCAACAATTCAACAACAGAGCCTATTCTAAAAACAAAAAAGGCCAGGTAAAGAGGAGTATTTTTGCTTCACCTGAGAGTGTGACTGGTAAAGTTGGAGTAGGAACCTGTGGAATTGCTGATAAACCTATGACACAATATCAAGATACCTCTAAATACAATGTCAGGCATTTGATGCCTCAATAA Translation Sequence: MSEDLAKQLA SYKAQLQQVE AALSGNGENE DLLKLKKDLQ EVIELTKDLL STQPSETLAS SDSFASTQPT HSWKVGDKCM AVWSEDGQCY EAEIEEIDEE NGTAAITFAG YGNAEVTPLL NLKPVEEGRK AKEDSGNKPM SKKEMIAQQR EYKKKKALKK AQRIKELEQE REDQKVKWQQ FNNRAYSKNK KGQVKRSIFA SPESVTGKVG VGTCGIADKP MTQYQDTSKY NVRHLMPQ Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
