SNRPD2 cDNA

Catalog Number: USB-552291
Article Name: SNRPD2 cDNA
Biozol Catalog Number: USB-552291
Supplier Catalog Number: 552291
Alternative Catalog Number: USB-552291-10
Manufacturer: US Biological
Category: Molekularbiologie
SNRPD2 encoded by this gene belongs to the small nuclear ribonucleoprotein core protein family. SNRPD2 is required for pre-mRNA splicing and small nuclear ribonucleoprotein biogenesis. Multiple transcript variants encoding different isoforms have been found for SNRPD2. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 357bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGAGCCTCCTCAACAAGCCCAAGAGTGAGATGACCCCAGAGGAGCTGCAGAAGCGAGAGGAGGAGGAATTTAACACCGGTCCACTCTCTGTGCTCACACAGTCAGTCAAGAACAATACCCAAGTGCTCATCAACTGCCGCAACAATAAGAAACTCCTGGGCCGCGTGAAGGCCTTCGATAGGCACTGCAACATGGTGCTGGAGAACGTGAAGGAGATGTGGACTGAGGTACCCAAGAGTGGCAAGGGCAAGAAGAAGTCCAAGCCAGTCAACAAAGACCGCTACATCTCCAAGATGTTCCTGCGCGGGGACTCAGTCATCGTGGTCCTGCGGAACCCGCTCATCGCCGGCAAGTAG Translation Sequence: MSLLNKPKSE MTPEELQKRE EEEFNTGPLS VLTQSVKNNT QVLINCRNNK KLLGRVKAFDRHCNMVLENV KEMWTEVPKS GKGKKKSKPV NKDRYISKMF LRGDSVIVVL RNPLIAGK Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 004588
Form: Supplied as a lyophilized powder.