Core component of the spliceosomal U1, U2, U4 and U5 small nuclear ribonucleoproteins (snRNPs), the building blocks of the spliceosome. Thereby, plays an important role in the splicing of cellular pre-mRNAs. Most spliceosomal snRNPs contain a common set of Sm proteins SNRPB, SNRPD1, SNRPD2, SNRPD3, SNRPE, SNRPF and SNRPG that assemble in an heptameric protein ring on the Sm site of the small nuclear RNA to form the core snRNP. As part of the U7 snRNP it is involved in histone 3-end processing. May indirectly play a role in hair development. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 279bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGCGTACCGTGGCCAGGGTCAGAAAGTGCAGAAGGTTATGGTGCAGCCCATCAACCTCATCTTCAGATACTTACAAAATAGATCGCGGATTCAGGTGTGGCTCTATGAGCAAGTGAATATGCGGATAGAAGGCTGTATCATTGGTTTTGATGAGTATATGAACCTTGTATTAGATGATGCAGAAGAGATTCATTCTAAAACAAAGTCAAGAAAACAACTGGGTCGGATCATGCTAAAAGGAGATAATATTACTCTGCTACAAAGTGTCTCCAACTAG Translation Sequence: MAYRGQGQKV QKVMVQPINL IFRYLQNRSR IQVWLYEQVN MRIEGCIIGF DEYMNLVLDDAEEIHSKTKS RKQLGRIMLK GDNITLLQSV SN Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.