SRP19 (Signal Recognition Particle 19kD) belongs to the SRP19 family. It binds directly to 7S RNA and mediates binding of the 54kD subunit of the SRP. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 435bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGCTTGCGCTGCCGCGCGGTCCCCGGCCGACCAGGACAGGTTTATTTGTATCTATCCTGCTTATTTAAATAATAAGAAGACCATCGCAGAGGGAAGGCGAATCCCCATAAGTAAGGCTGTTGAAAATCCTACAGCTACAGAGATTCAAGATGTATGTTCAGCAGTTGGACTTAACGTATTTCTTGAGAAAAATAAAATGTACTCTAGAGAATGGAATCGTGATGTCCAATACAGAGGCAGAGTCCGGGTCCAGCTCAAACAGGAAGATGGGAGCCTCTGCCTTGTACAGTTCCCATCACGTAAGTCAGTAATGTTGTATGCAGCAGAAATGATACCTAAACTAAAAACAAGGACACAAAAAACAGGAGGTGCTGACCAAAGTCTTCAACAAGGAGAGGGAAGTAAAAAAGGGAAAGGAAAGAAAAAGAAGTAA Translation Sequence: MACAAARSPA DQDRFICIYP AYLNNKKTIA EGRRIPISKA VENPTATEIQ DVCSAVGLNVFLEKNKMYSR EWNRDVQYRG RVRVQLKQED GSLCLVQFPS RKSVMLYAAE MIPKLKTRTQKTGGADQSLQ QGEGSKKGKG KKKK Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.