SSX1 belongs to the family of highly homologous synovial sarcoma X (SSX) breakpoint proteins. These proteins may function as transcriptional repressors. This gene, and also the SSX2 and SSX4 family members, have been involved in t (X,18) (p11. 2,q11. 2) translocations that are characteristically found in all synovial sarcomas. This translocation results in the fusion of the synovial sarcoma translocation gene on chromosome 18 to one of the SSX genes on chromosome X. The encoded hybrid proteins are likely responsible for transforming activity. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome X. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 567bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGAACGGAGACGACACCTTTGCAAAGAGACCCAGGGATGATGCTAAAGCATCAGAGAAGAGAAGCAAGGCCTTTGATGATATTGCCACATACTTCTCTAAGAAAGAGTGGAAAAAGATGAAATACTCGGAGAAAATCAGCTATGTGTATATGAAGAGAAACTATAAGGCCATGACTAAACTAGGTTTCAAAGTCACCCTCCCACCTTTCATGTGTAATAAACAGGCCACAGACTTCCAGGGGAATGATTTTGATAATGACCATAACCGCAGGATTCAGGTTGAACATCCTCAGATGACTTTCGGCAGGCTCCACAGAATCATCCCGAAGATCATGCCCAAGAAGCCAGCAGAGGACGAAAATGATTCGAAGGGAGTGTCAGAAGCATCTGGCCCACAAAACGATGGGAAACAACTGCACCCCCCAGGAAAAGCAAATATTTCTGAGAAGATTAATAAGAGATCTGGACCCAAAAGGGGGAAACATGCCTGGACCCACAGACTGCGTGAGAGAAAGCAGCTGGTGATTTATGAAGAGATCAGTGACCCTGAGGAAGATGACGAGTAA Translation Sequence: MNGDDTFAKR PRDDAKASEK RSKAFDDIAT YFSKKEWKKM KYSEKISYVY MKRNYKAMTK LGFKVTLPPF MCNKQATDFQ GNDFDNDHNR RIQVEHPQMT FGRLHRIIPK IMPKKPAEDE NDSKGVSEAS GPQNDGKQLH PPGKANISEK INKRSGPKRG KHAWTHRLRE RKQLVIYEEI SDPEEDDE Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
