TAGLN encoded by this gene is a transformation and shape-change sensitive actin cross-linking/gelling protein found in fibroblasts and smooth muscle. Its expression is down-regulated in many cell lines, and this down-regulation may be an early and sensitive marker for the onset of transformation. A functional role of this protein is unclear. Two transcript variants encoding the same protein have been found for this gene. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 606bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGCCAACAAGGGTCCTTCCTATGGCATGAGCCGCGAAGTGCAGTCCAAAATCGAGAAGAAGTATGACGAGGAGCTGGAGGAGCGGCTGGTGGAGTGGATCATAGTGCAGTGTGGCCCTGATGTGGGCCGCCCAGACCGTGGGCGCTTGGGCTTCCAGGTCTGGCTGAAGAATGGCGTGATTCTGAGCAAGCTGGTGAACAGCCTGTACCCTGATGGCTCCAAGCCGGTGAAGGTGCCCGAGAACCCACCCTCCATGGTCTTCAAGCAGATGGAGCAGGTGGCTCAGTTCCTGAAGGCGGCTGAGGACTATGGGGTCATCAAGACTGACATGTTCCAGACTGTTGACCTCTTTGAAGGCAAAGACATGGCAGCAGTGCAGAGGACCCTGATGGCTTTGGGCAGCTTGGCAGTGACCAAGAATGATGGGCACTACCGTGGAGATCCCAACTGGTTTATGAAGAAAGCGCAGGAGCATAAGAGGGAATTCACAGAGAGCCAGCTGCAGGAGGGAAAGCATGTCATTGGCCTTCAGATGGGCAGCAACAGAGGGGCCTCCCAGGCCGGCATGACAGGCTACGGACGACCTCGGCAGATCATCAGTTAG Translation Sequence: MANKGPSYGM SREVQSKIEK KYDEELEERL VEWIIVQCGP DVGRPDRGRL GFQVWLKNGV ILSKLVNSLY PDGSKPVKVP ENPPSMVFKQ MEQVAQFLKA AEDYGVIKTD MFQTVDLFEG KDMAAVQRTL MALGSLAVTK NDGHYRGDPN WFMKKAQEHK REFTESQLQE GKHVIGLQMG SNRGASQAGM TGYGRPRQII S Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
