TSC22D3 shares significant sequence identity with the murine TSC-22 and Drosophila shs, both of which are leucine zipper proteins, that function as transcriptional regulators. The expression of this gene is stimulated by glucocorticoids and interleukin 10, and it appears to play a key role in the anti-inflammatory and immunosuppressive effects of this steroid and chemokine. Transcript variants encoding different isoforms have been identified for this gene. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 405bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGAACACCGAAATGTATCAGACCCCCATGGAGGTGGCGGTCTACCAGCTGCACAATTTCTCCATCTCCTTCTTCTCTTCTCTGCTTGGAGGGGATGTGGTTTCCGTTAAGCTGGACAACAGTGCCTCCGGAGCCAGCGTGGTGGCCATAGACAACAAGATCGAACAGGCCATGGATCTGGTGAAGAATCATCTGATGTATGCTGTGAGAGAGGAGGTGGAGATCCTGAAGGAGCAGATCCGAGAGCTGGTGGAGAAGAACTCCCAGCTAGAGCGTGAGAACACCCTGTTGAAGACCCTGGCAAGCCCAGAGCAGCTGGAGAAGTTCCAGTCCTGTCTGAGCCCTGAAGAGCCAGCTCCCGAATCCCCACAAGTGCCCGAGGCCCCTGGTGGTTCTGCGGTGTAA Translation Sequence: MNTEMYQTPM EVAVYQLHNF SISFFSSLLG GDVVSVKLDN SASGASVVAI DNKIEQAMDL VKNHLMYAVR EEVEILKEQI RELVEKNSQL ERENTLLKTL ASPEQLEKFQ SCLSPEEPAP ESPQVPEAPG GSAV Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
