UCHL3 cDNA

Catalog Number: USB-552351
Article Name: UCHL3 cDNA
Biozol Catalog Number: USB-552351
Supplier Catalog Number: 552351
Alternative Catalog Number: USB-552351-10
Manufacturer: US Biological
Category: Molekularbiologie
UCHL3 is a member of the deubiquitinating enzyme family. Members of this family are proteases that catalyze the removal of ubiquitin from polypeptides and are divided into five classes, depending on the mechanism of catalysis. This protein may hydrolyze the ubiquitinyl-N-epsilon amide bond of ubiquitinated proteins to regenerate ubiquitin for another catalytic cycle. Alternative splicing results in multiple transcript variants that encode different protein isoforms. Vector Description: This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 693bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGAGGGTCAACGCTGGCTGCCGCTGGAGGCCAATCCCGAGGTCACCAACCAGTTTCTTAAACAATTAGGTCTACATCCTAACTGGCAATTCGTTGATGTATATGGAATGGATCCTGAACTCCTTAGCATGGTACCAAGACCAGTCTGTGCAGTCTTACTTCTCTTTCCTATTACAGAAAAGTATGAAGTATTCAGAACAGAAGAGGAAGAAAAAATAAAATCTCAGGGACAAGATGTTACATCATCAGTATATTTCATGAAGCAAACAATCAGCAATGCCTGTGGAACAATTGGACTGATTCATGCTATTGCAAACAATAAAGACAAGATGCACTTTGAATCTGGATCAACCTTGAAAAAATTCCTGGAGGAATCTGTGTCAATGAGCCCTGAAGAACGAGCCAGATACCTGGAGAACTATGATGCCATCCGAGTTACTCATGAGACCAGTGCCCATGAAGGTCAGACTGAGGCACCAAGTATAGATGAGAAAGTAGATCTTCATTTTATTGCATTAGTTCATGTAGATGGGCATCTCTATGAATTAGATGGGCGGAAGCCATTTCCAATTAACCATGGTGAAACTAGTGATGAAACTTTATTAGAGGATGCCATAGAAGTTTGCAAGAAGTTTATGGAGCGCGACCCTGATGAACTAAGATTTAATGCGATTGCTCTTTCTGCAGCATAG Translation Sequence: MEGQRWLPLE ANPEVTNQFL KQLGLHPNWQ FVDVYGMDPE LLSMVPRPVC AVLLLFPITE KYEVFRTEEE EKIKSQGQDV TSSVYFMKQT ISNACGTIGL IHAIANNKDK MHFESGSTLK KFLEESVSMS PEERARYLEN YDAIRVTHET SAHEGQTEAP SIDEKVDLHF IALVHVDGHL YELDGRKPFP INHGETSDET LLEDAIEVCK KFMERDPDEL RFNAIALSAA Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 005993
Form: Supplied as a lyophilized powder.