Von Hippel-Lindau (VHL) tumor suppressor protein is a component of an E3 ubiquitin ligase complex that selectively ubiquitinates the alpha subunit of the hypoxia-inducible factor (HIF) transcription factor for proteasome-mediated degradation. Inactivation of VHL causes VHL disease and sporadic kidney cancer. This gene encodes a VHL homolog that lacks one of two key domains necessary for VHL function. This gene may contribute to the regulation of oxygen homeostasis and neovascularization during placenta development. This gene is intronless, and can also be interpreted as a retrotransposed pseudogene of the VHL locus located on chromosome 3. However, the protein is represented in this RefSeq due to evidence in PMID:14757845 that strongly suggests it is translated. The same publication also indicates that this protein binds HIF alpha but fails to recruit the E3 ubiquitin ligase complex, and it therefore functions as a dominant-negative VHL protein and a protector of HIF alpha. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 420bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGCCCTGGAGAGCGGGGAACGGGGTGGGTTTAGAGGCCCAGGCGGGCACCCAGGAGGCAGGCCCAGAAGAGTACTGCCAGGAAGAGTTGGGCGCCGAGGAGGAGATGGCAGCCAGAGCAGCATGGCCTGTGCTGCGCTCTGTGAACTCACGCGAGCTCTCCCGGATCATCATCTGCAATCACAGCCCACGAATCGTGCTGCCTGTGTGGCTCAACTACTATGGCAAGCTGCTGCCCTACCTGACGCTGCTGCCCGGCAGGGACTTCCGCATCCACAACTTCCGAAGCCACCCTTGGCTCTTCAGAGATGCAAGGACACATGATAAGCTTCTGGTTAACCAAACTGAATTGTTTGTGCCATCTTCCAATGTTAATGGACAGCCTGTTTTTGCCAACATCACACTGCAGTGTATACCCTGA Translation Sequence: MPWRAGNGVG LEAQAGTQEA GPEEYCQEEL GAEEEMAARA AWPVLRSVNS RELSRIIICN HSPRIVLPVW LNYYGKLLPY LTLLPGRDFR IHNFRSHPWL FRDARTHDKL LVNQTELFVP SSNVNGQPVF ANITLQCIP Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.