ZNRD1 cDNA

Catalog Number: USB-552370
Article Name: ZNRD1 cDNA
Biozol Catalog Number: USB-552370
Supplier Catalog Number: 552370
Alternative Catalog Number: USB-552370-10
Manufacturer: US Biological
Category: Molekularbiologie
ZNRD1 is a DNA-directed RNA polymerase I subunit. It contains two potential zinc-binding motifs and may play a role in regulation of cell proliferation. ZNRD1 may be involved in cancer and human immunodeficiency virus progression. Alternative splicing results in multiple transcript variants. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 381bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGTCTGTCATGGACCTCGCCAATACTTGCTCCAGCTTTCAGTCGGACCTGGATTTCTGTTCAGATTGCGGCTCGGTCCTGCCTCTGCCCGGGGCTCAGGATACGGTCACCTGTATTCGCTGTGGCTTCAACATCAACGTTCGGGACTTTGAGGGGAAGGTTGTGAAGACTTCGGTTGTGTTCCACCAACTGGGGACAGCCATGCCTATGTCGGTGGAGGAAGGGCCTGAGTGCCAGGGACCTGTGGTTGACAGGCGCTGCCCTCGATGTGGTCATGAAGGAATGGCATACCACACCAGACAGATGCGTTCAGCCGATGAAGGGCAAACTGTCTTCTACACCTGTACCAACTGCAAGTTCCAGGAGAAGGAAGACTCTTGA Translation Sequence: MSVMDLANTC SSFQSDLDFC SDCGSVLPLP GAQDTVTCIR CGFNINVRDF EGKVVKTSVVFHQLGTAMPM SVEEGPECQG PVVDRRCPRC GHEGMAYHTR QMRSADEGQT VFYTCTNCKFQEKEDS Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 740753
Form: Supplied as a lyophilized powder.