FXYD domain-containing Ion Transport Regulator 3, Recombinant, Human, aa21-38, His-SUMO-Tag
Biozol Catalog Number:
USB-584598
Supplier Catalog Number:
584598
Alternative Catalog Number:
USB-584598-20,USB-584598-100
Manufacturer:
US Biological
Category:
Molekularbiologie
Associates with and regulates the activity of the sodium/potassium-transporting ATPase (NKA) which transports Na(+) out of the cell and K(+) into the cell. Reduces glutathionylation of the NKA beta-1 subunit ATP1B1, thus reversing glutathionylation-mediated inhibition of ATP1B1. Induces a hyperpolarization-activated chloride current when expressed in Xenopus oocytes., Decreases the apparent K+ and Na+ affinity of the sodium/potassium-transporting ATPase over a large range of membrane potentials., Decreases the apparent K+ affinity of the sodium/potassium-transporting ATPase only at slightly negative and positive membrane potentials and increases the apparent Na+ affinity over a large range of membrane potentials. Source: Recombinant protein corresponding to aa21-38 from human FXYD domain-containing ion transport regulator 3, fused to 6X His-SUMO-Tag at N-terminal, expressed in E.coli. Molecular Weight: ~20.5kD Amino Acid Sequence: AATGACCTAGAAGATAAAAACAGTCCTTTCTACTATGACTGGCACAGCCTCCAG Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap. Further dilutions can be made in assay buffer.
Supplied as a lyophilized powder from 20mM Tris-HCl, 0.5M sodium chloride, pH 8.0, 6% trehalose. Reconstitute with sterile ddH2O to a concentration of 0.1-1mg/ml.
* VAT and and shipping costs not included. Errors and price changes excepted